food fakultät | Mensa am Campus Nord Dortmund

21) S: 5,00 € B: 7,10 € G: 8,20 € Pasta Pesto Basilico: Basil pesto (2,20a,22,26) S: 4,50 € B: 6,60 € G: 7,70 € Pasta Bolognese: Bolognese of beef (20a) | Bolognese (28) S: 5,00 € B: 7,10 € G: 8,20 € Pasta [...] 60 € G: 7,70 € Pasta Carbonara: Bacon | onions | cream sauce (1,2,9,20a,26) S: 4,50 € B: 6,60 € G: 7,70 € Pasta Crema di Funghi: Fresh mushrooms | cream sauce (20a,26) S: 4,50 € B: 6,60 € G: 7,70 € red [...] B: 6,10 € G: 7,20 € Pizza Anti Pasti: Grilled vegetables | Gouda (20a,20c,25,26) S: 4,50 € B: 6,60 € G: 7,70 € Pizza Caprese: Tomato | Mozzarella (20a,20c,25,26) S: 4,50 € B: 6,60 € G: 7,70 € Pizza Funghi: …

Mitungi as … thinking about urban space and infrastructure with the jerry can

!# 7 2 "! " 7 # %# #% &#6K# # =9F # 1 =0 ' 2 # ""# 2 # 7 ##$ ##$ , D % "#6" -" # ## " 2 # I! N !# >7 6 ' ? + ! , 7 ) - [...] )% ! . 0## #6 )% #! # 6 # 7 % # D$ I # " 6 ( $ # #7* & " @J' # 0# "" # $ ##$ % &G! ? ' , 7# !#! 3 7 " 0 ## ! # # G [...] F!# # # "# I# ! "8 - $ % 6 $ !# # " " " $ " . 7 7 + ! , 7 ) - G H + ! , 7 ) - -3:, 56) + 2 "# 2 ##% !6-" "#! "# "# "# …

let-7 is recognized as a crucial tumor-suppressive miRNA.77ï79 There are twelve known members of the let-7 miRNA family: let-7a-1, let-7a-2, let-7a-3, let-7b, let- 7c-1, let-7c-2, let-7d, let-7e, let-7f-1 [...] let-7 sequences compared to the consensus sequence are highlighted in bold font. UGAGGUAGUAGGUUGUAUAGUUConsensus UGAGGUAGUAGGUUGUAUAGUU UGAGGUAGUAGGUUGUAUAGUU let-7a-1 let-7a-2 let-7b let-7c-1 let-7c-2 [...] let-7c-2 let-7d let-7e let-7f-1 let-7f-2 let-7g let-7i mir-98 UGAGGUAGUAGGUUGUGUGGUU UGAGGUAGUAGGUUGUAUGGUU UGAGGUAGUAGGUUGUAUGGUU AGAGGUAGUAGGUUGCAUAGUU UGAGGUAGGAGGUUGUAUGGUU UGAGGUAGUAGAUUGUAUAGUU UGAGGUAG …

Träger nicht angeboten 54 3.36 56 3.32 7 1.71 48 3.35 54 3.36 31 3.10 77 2.79 88 2.10 Berlin Für alle Einrichtungen verbindlich 41 7.55 33 7.24 62 7.32 62 7.11 53 7.57 27 7.29 25 6.74 28 6.93 Wird den Einrichtungen [...] 8 22 4.7 4 0.9 Sachsen 2,348 891 37.9 1,457 62.1 181 7.7 415 17.7 117 5.0 278 11.8 39 1.7 376 16.0 51 2.2 Sachsen-Anhalt 1,414 790 55.9 624 44.1 58 4.1 185 13.1 26 1.8 144 10.2 31 2.2 179 12.7 1 0.1 S [...] 46 2.6 Thüringen 1,330 502 37.7 828 62.3 156 11.7 235 17.7 93 7.0 187 14.1 72 5.4 70 5.3 15 1.1 Westdeutschland 43,470 13,673 31.5 29,797 68.5 1,771 4.1 3,162 7.3 1,245 2.9 7,629 17.6 8,942 20.6 5,622 12 …

.de/signposting/linksets/185c71b2-7a13-438f-bc5e-c0cd4d9beee1","type":"application/linkset"},{"href":"https://eldorado.tu-dortmund.de/signposting/linksets/185c71b2-7a13-438f-bc5e-c0cd4d9beee1/json","t [...] de/signposting/describedby/185c71b2-7a13-438f-bc5e-c0cd4d9beee1","type":"application/vnd.datacite.datacite+xml"}],"anchor":"https://eldorado.tu-dortmund.de/items/185c71b2-7a13-438f-bc5e-c0cd4d9beee1","cit [...] do.tu-dortmund.de/items/185c71b2-7a13-438f-bc5e-c0cd4d9beee1","type":"text/html"}],"linkset":[{"href":"https://eldorado.tu-dortmund.de/signposting/linksets/185c71b2-7a13-438f-bc5e-c0cd4d9beee1","type" …

tu-dortmund.de/signposting/linksets/19dd7a1f-a58e-4c49-bc77-32e901af5357","type":"application/linkset"},{"href":"https://eldorado.tu-dortmund.de/signposting/linksets/19dd7a1f-a58e-4c49-bc77-32e901af5357/json" [...] .de/signposting/describedby/19dd7a1f-a58e-4c49-bc77-32e901af5357","type":"application/vnd.datacite.datacite+xml"}],"anchor":"https://eldorado.tu-dortmund.de/items/19dd7a1f-a58e-4c49-bc77-32e901af5357" [...] ldorado.tu-dortmund.de/items/19dd7a1f-a58e-4c49-bc77-32e901af5357","type":"text/html"}],"linkset":[{"href":"https://eldorado.tu-dortmund.de/signposting/linksets/19dd7a1f-a58e-4c49-bc77-32e901af5357"," …

/linksets/1bd047cd-2593-450d-b25f-7d1e0d39652d","type":"application/linkset"},{"href":"https://eldorado.tu-dortmund.de/signposting/linksets/1bd047cd-2593-450d-b25f-7d1e0d39652d/json","type":"applicati [...] ribedby/1bd047cd-2593-450d-b25f-7d1e0d39652d","type":"application/vnd.datacite.datacite+xml"}],"anchor":"https://eldorado.tu-dortmund.de/items/1bd047cd-2593-450d-b25f-7d1e0d39652d","cite-as":[{"href": [...] de/items/1bd047cd-2593-450d-b25f-7d1e0d39652d","type":"text/html"}],"linkset":[{"href":"https://eldorado.tu-dortmund.de/signposting/linksets/1bd047cd-2593-450d-b25f-7d1e0d39652d","type":"application/linkset"} …